Table 1 Primer pairs and conditions used in the PCR to detect H. pylori genes (ureA, cagA and 3’ variable region of the cagA gene that contains EPIYA sequences) and in qRT-PCR to genotype STAT3 rs744166 and to evaluate STAT3 mRNA expression
Gene | Primers (5’ – 3’) | PCR conditions | PCR Product (bp) | Reference |
|---|---|---|---|---|
ureA | F: GCCAATGGTAAATTAGTT | 95 °C - 5 min.; 34 cycles (94 °C 1 min., 45 °C - 1 min. and 72 °C - 1 min.) and 72 °C - 5 min. | 411 | 34 |
R: CTCCTTAATTGTTTTTAC | ||||
cagA | F:CTGCAAAAGATTGTTTGCGAGA | 95 °C - 5 min, 34 cycles (95 °C 1 min, 50 °C-1 min and 72 °C-1 min) and 72 °C - 15 min | 400 | 35 |
R:AGACGGTTTGTTAGAAAACGTC | ||||
cagA | F:GATAACAGGCAAGCTTTTGAGG | 95 °C - 5 min, 38 cycles (94 °C 1 min, 55 °C - 1 min and 72 °C - 2 min.) and 72 °C - 7 min. | 349 | 36 |
R:CTGCAAAAGATTGTTTGCGAGA | ||||
cagA 3’ variable region | F: ACCCTAGTCGGTAATGGGTTA | 95 °C - 5 min, 35 cycles (95 °C 1 min, 50 °C-1 min and 72 °C-1 min.) and 72 °C - 7 min | 500 - 850 | 37 |
R: GTAATTGTCTAGTTTCGC | ||||
STAT3a Rs744166 | CTGTTTGTTCTATAAATTACTGTCA[A/G]GCTCGATTCCCTCAAGACATTACAG | 60 °C - 1 min., 95 °C - 10 min., 50 cycles (95 °C - 15 s., 50 °C - 90 s.) and 60 °C - 1 min. | 70 |